mgsA [2019-02-19 17:28:49]

methylglyoxal synthase

Locus: BSU22480

Isoelectric point: 4.92

Molecular weight: 14.99 kDa

Protein length: 137 aa

Gene length: 414 bp

Function: bypass of glycolysis

Product: methylglyoxal synthase

Essential: no

E.C.: 4.2.3.3

Synonyms: ypjF,jojF

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Carbon metabolism → Carbon core metabolism → Glycolysis

Gene

Coordinates: 2,358,911 2,359,324

The protein

Catalyzed reaction/ biological activity

• Glycerone phosphate = methylglyoxal + phosphate (according to Swiss-Prot)

Effectors of protein activity

• non-phosphorylated Crh interacts with MgsA to inhibit its activity PubMed

Structure

• 6F2C PubMed

Expression and Regulation

Operons

• Genes: ypjD-dapB-mgsA-bshB1-bshA-cca-birA
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • Spx: activation, PubMed, in Spx regulon

  Regulation

  • induced by diamide stess (thiol depletion) (Spx) PubMed

Biological materials

Mutant

• MGNA-A440 (mgsA::erm), available at the NBRP B. subtilis, Japan
• GP67 (mgsA::tet) PubMed, available in Jrg Stlke's lab
• GP84 (mgsA::pX2(cat)), available in Jrg Stlke's lab
• BKE22480 (mgsA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_AATTTTCATTGTTTATCCCC, downstream forward: _UP4_GACCTTCTTCGGGGAGAAGA
• BKK22480 (mgsA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_AATTTTCATTGTTTATCCCC, downstream forward: _UP4_GACCTTCTTCGGGGAGAAGA

Expression vectors

• pGP1301 (N-terminal Strep-tag, purification from E. coli, in pGP172), available in Jrg Stlke's lab
• pGP1180 (N-terminal Strep-tag, purification from B. subtilis, for SPINE, in pGP380), available in Jrg Stlke's lab
• pGP1181 (C-terminal Strep-tag, purification from B. subtilis, for SPINE, in pGP382), available in Jrg Stlke's lab
• pGP2207 (N-terminal Strep-tag, purification from B. subtilis, for SPINE, in pGP1459), available in Jrg Stlke's lab
• pGP2505 (N-terminal His-tag, purification from E. coli, in pWH844), available in Jrg Stlke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jrg Stlke's lab PubMed

FLAG-tag construct

• GP86 (spc, based on pGP1331) PubMed, available in Jrg Stlke's lab

Labs working on this gene/protein

• Boris Grke, University of Vienna, Austria
• Jrg Stlke, University of Gttingen, Germany, Homepage

References

Loading